Hey, when I tried to enter following sequence, I received an error:
ATG GCG GCT GAG ATT CTG GCG GGT
The problem seems to be that Wolfram|Alpha can only recognize sequences that look like this:
ATGGCGGCTGAGATTCTGGCGGGT
which is not the way that most programs on the internet output their data. Removing every space from a large sequence (e.g. 500 base pairs) is extremely painful, so I think Wolfram|Alpha should support this format!
It would also be neat if W|A would support FASTA or Genebank formatting, and if it could at least tell me the reverse complement of a sequence I enter!
Life Sciences
Problems with DNA sequences
Page 1 of 1
• [ 3 posts ]
Problems with DNA sequences
- katar8
- Posts: 7
- Joined: Fri May 29, 2009 9:32 am
Re: Problems with DNA sequences
Of course, what you describe are real issues, but...
To remove all of the spaces from a string, copy the string into the "dumbest editor anywhere" (like Notepad) and use Edit>>Replace to replace all spaces " " with nothing "". Then give it to W|A.
Regards..RogerW
To remove all of the spaces from a string, copy the string into the "dumbest editor anywhere" (like Notepad) and use Edit>>Replace to replace all spaces " " with nothing "". Then give it to W|A.
Regards..RogerW
- relishguy
- Posts: 9
- Joined: Sun May 24, 2009 4:01 am
Re: Problems with DNA sequences
relishguy wrote:Of course, what you describe are real issues, but...
To remove all of the spaces from a string, copy the string into the "dumbest editor anywhere" (like Notepad) and use Edit>>Replace to replace all spaces " " with nothing "". Then give it to W|A.
Regards..RogerW
Thanks RogerW, It's working now.
- adward
- Posts: 22
- Joined: Wed Mar 02, 2011 12:49 pm
Page 1 of 1
• [ 3 posts ]
Who is online
Users browsing this forum: yenolleaqh and 1 guest
