Life Sciences

Problems with DNA sequences

Problems with DNA sequences

Postby katar8 » Wed Jun 24, 2009 8:38 am
Hey, when I tried to enter following sequence, I received an error:

ATG GCG GCT GAG ATT CTG GCG GGT

The problem seems to be that Wolfram|Alpha can only recognize sequences that look like this:

ATGGCGGCTGAGATTCTGGCGGGT

which is not the way that most programs on the internet output their data. Removing every space from a large sequence (e.g. 500 base pairs) is extremely painful, so I think Wolfram|Alpha should support this format!

It would also be neat if W|A would support FASTA or Genebank formatting, and if it could at least tell me the reverse complement of a sequence I enter!

katar8
 
Posts: 7
Joined: Fri May 29, 2009 9:32 am

Re: Problems with DNA sequences

Postby relishguy » Mon Jul 13, 2009 12:10 am
Of course, what you describe are real issues, but...

To remove all of the spaces from a string, copy the string into the "dumbest editor anywhere" (like Notepad) and use Edit>>Replace to replace all spaces " " with nothing "". Then give it to W|A.

Regards..RogerW
relishguy
 
Posts: 9
Joined: Sun May 24, 2009 4:01 am

Re: Problems with DNA sequences

Postby adward » Wed Dec 07, 2011 2:52 pm
relishguy wrote:Of course, what you describe are real issues, but...

To remove all of the spaces from a string, copy the string into the "dumbest editor anywhere" (like Notepad) and use Edit>>Replace to replace all spaces " " with nothing "". Then give it to W|A.

Regards..RogerW


Thanks RogerW, It's working now.
adward
 
Posts: 22
Joined: Wed Mar 02, 2011 12:49 pm

Who is online

Users browsing this forum: No registered users and 1 guest